Hello world program in esoteric languages
|
This page shows the hello world program in esoteric programming languages.
Contents |
23
30,14,16,101,16,108,16,32,16,111,16,108,1,12,16,72,16,108,16,111,16,87,16,114,16,100,16,33
4DL
See [1] (http://www.cliff.biffle.org/esoterica/4dl-hello.gif) for a Hello, World program in 4DL.
Ale
\/>>>>>>\+\<<<\+!\>>\+\<<<<\-\<\-!\>>>\+\<<<\-!!+++!\/\-\/>>>>>\+\<<\+\<\+!---!\>>> \+\>\+\<<<\-\<<<\-!\>>>\-!\<<\+\<\+!\>\-\>\-!\>\-!\/\-/>>>>>\+\<<<<<\+!\/\-\/>>>\+\<<\+!
Argh!
j world! lpppppppPPPPPPsrfj Hello, * j qPh
BDAMD
Note: this actually prints "HI" instead of "Hello, world".
84 > 84 > 84 > 84 > 84 > 84 > 84 > 85 \/ 85 < 86 < 86 < 86 < 86 < 86 < 0E < 66 \/ /\ 84 > 84 > 0C > 8C > E5 > 0F 84 > 85 \/ /\ \/ 85 < 86 < 86 < 3E < 0E 84 > 83 < 86 \/ /\ \/ 84 > 84 > 84 > 84 > 84 > 0F 84 > 85 \/ 00 < 00 < 00 < B6 < 0E < B6 < 0E < 86
Beatnik
Note: this actually prints "Hi" instead of "Hello, world".
Baa, badassed areas! Jarheads' arses queasy nude adverbs! Dare address abase adder? *bares baser dadas* HA! Equalize, add bezique, bra emblaze. He (quezal), aeons liable. Label lilac "bulla," ocean sauce! Ends, addends, duodena sounded amends.
Befunge
"!dlrow olleH">v : , ^_@
BlooP, FlooP
Though not defined in Douglas Hofstadter's book, print[] is a construct in the only FlooP compiler out there. If you want to go strictly with the book, then it'd be impossible to write out Hello World, except in numbers.
define procedure ''hello_world'' [n]: block 0: begin print['Hello world!']; block 0: end.
Boolfuck
;;;+;+;;+;+; +;+;+;+;;+;;+; ;;+;;+;+;;+; ;;+;;+;+;;+; +;;;;+;+;;+; ;;+;;+;+;+;; ;;;;;+;+;; +;;;+;+;;;+; +;;;;+;+;;+; ;+;+;;+;;;+; ;;+;;+;+;;+; ;;+;+;;+;;+; +;+;;;;+;+;; ;+;+;+;
Borg
main: "Hello, world!\n">out :
Brainfuck
++++++++++[>++++>++++++++++>+++++++<<<-] >>>++.<+.+++++++..+++.<++++.<+++[>----<-]>. >++++++++.--------.+++.------.--------.<<+++[>++++<-]>++.<++++++++++.
or
+++++++++ [ >+++++++>++++++++++>+++>+<<<<- ] >++. The initial loop after which an 'H' is printed >+. e +++++++. l . l +++. o >++. <<+++++++++++++++. >. +++. ------. --------. >+. >.
Chef
Hello World Souffle. Ingredients. 72 g haricot beans 101 eggs 108 g lard 111 cups oil 32 zucchinis 119 ml water 114 g red salmon 100 g dijon mustard 33 potatoes Method. Put potatoes into the mixing bowl. Put dijon mustard into the mixing bowl. Put lard into the mixing bowl. Put red salmon into the mixing bowl. Put oil into the mixing bowl. Put water into the mixing bowl. Put zucchinis into the mixing bowl. Put oil into the mixing bowl. Put lard into the mixing bowl. Put lard into the mixing bowl. Put eggs into the mixing bowl. Put haricot beans into the mixing bowl. Liquefy contents of the mixing bowl. Pour contents of the mixing bowl into the baking dish. Serves 1.
Choon
AGb-A#A#+A+%A#DF-AC#
Condit
when a=0 then put "Hello, world!" set a=1
DNA / Genetic code
The following code should theoretically translate to the peptide HELLQWQRLD, (cross fingers).
TACGTACTTAATAATGTTACCGTTGCAAATCTAATC
ETA
No heat: "hello.eta", written by Mike Taylor ** FUNGICIDE ** -- Fungus calendar -- CURTSEY: Fungal toe! Fungal toe! Fungal hoe! (Burnt programmer nucleus) Ooooooo! CRUDDY 2nd TOE: Nine(!) fungal hyaena toe5! Dungy alfalfa, penalty superlunary -- Oh, blubber! Oo! Oooo! OW!
Gammaplex
X"Hello World!"XXSXrRE
HQ9+
H
INTERCAL
PLEASE DO ,1 <- #13 DO ,1 SUB #1 <- #238 DO ,1 SUB #2 <- #112 DO ,1 SUB #3 <- #112 DO ,1 SUB #4 <- #0 DO ,1 SUB #5 <- #64 DO ,1 SUB #6 <- #238 DO ,1 SUB #7 <- #26 DO ,1 SUB #8 <- #248 DO ,1 SUB #9 <- #168 DO ,1 SUB #10 <- #24 DO ,1 SUB #11 <- #16 DO ,1 SUB #12 <- #158 DO ,1 SUB #13 <- #52 PLEASE READ OUT ,1 PLEASE GIVE UP
L33t
Note: this actually prints "H3LL0 W0RLD!!!" instead of "Hello, world!"
// "Hello World" by Stephen McGreal. // Note that the views expressed in this source code do not necessarily // coincide with those of the author :o) Gr34t l33tN3$$? M3h... iT 41n't s0 7rIckY. l33t sP33k is U8er keWl 4nD eA5y wehn u 7hink 1t tHr0uGh. 1f u w4nn4be UB3R-l33t u d3f1n1t3lY w4nt in 0n a b4d4sS h4xX0r1ng s1tE!!! ;p w4r3Z c0ll3cT10n2 r 7eh l3Et3r! Qu4k3 cL4nS r 7eh bE5t tH1ng 1n teh 3nTIr3 w0rlD!!! g4m3s wh3r3 u g3t to 5h00t ppl r 70tAl1_y w1cK1d!! I'M teh fr4GM4stEr aN I'lL t0t41_1Ly wIpE teh phr34k1ng fL00r ***j3d1 5tYlE*** wItH y0uR h1dE!!!! L0L0L0L! t3lEphR4gG1nG l4m3rs wit mY m8tes r34lLy k1kK$ A$$ l33t hAxX0r$ CrE4t3 u8er- k3wL 5tUff lIkE n34t pR0gR4mm1nG lAnguidGe$... s0m3tIm3$ teh l4nGu4gES l00k jUst l1k3 rE41_ 0neS 7o mAkE ppl Th1nk th3y'r3 ju$t n0rMal lEE7 5pEEk but th3y're 5ecRetLy c0dE!!!! n080DY unDer5tAnD$ l33t SpEaK 4p4rT fr0m j3d1!!!!! 50mE kId 0n A me$$4gEb04rD m1ghT 8E a r0xX0r1nG hAxX0r wH0 w4nT2 t0 bR34k 5tuFf, 0r mAyb3 ju5t sh0w 7eh wAy5 l33t ppl cAn 8E m0re lIkE y0d4!!! hE i5 teh u8ER!!!! 1t m1ght 8E 5omE v1rus 0r a Pl4ySt4tI0n ch34t c0dE. 1t 3v3n MiTe jUs7 s4y "H3LL0 W0RLD!!!" u ju5t cAn'T gu3s5. tH3r3's n3v3r anY p0iNt l00KiNg sC3pT1c4l c0s th4t, be1_1Ev3 iT 0r n0t, 1s whAt th1s 1s!!!!! 5uxX0r5!!!L0L0L0L0L!!!!!!!
LSL
default { state_entry() { llSay(0, "Hello, world!"); } }
Malbolge
(=<`:9876Z4321UT.-Q+*)M'&%$H"!~}|Bzy?=|{z]KwZY44Eq0/{mlk**hKs_dG5[m_BA{?-Y;;Vb'rR5431M}/.zHGwEDCBA@98\6543W10/.R,+O<
Mouse
"HELLO, WORLD.!" $$
nouse
#0<a>0:0#0>e>0:0#0>f>0>0:0#0^f>0:0#0+4>0:0#0#h>0:0#0^f>0:0#0<g>0:0#0>f >0:0#0<e>0:0#0?4>0:0#0^1>0:0#0>1>0:0^0
Numberix
A0000159006CA9006C590057A9006F590064A90021000000000000000000000000000000000000 59004809006559006F09002059007209006CFF0000
NULL
Following number is a 176-digit program which prints "Hello, world!". You should ignore all newlines.
153609393637869503971282839335995386248921743204830348570033550157913898858976 126298703504031567456769368158187308369080756461086944119139087533415422490572 83074613678144889367
Obfuna
!<Hello, world!>
Ook!
Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook! Ook. Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook. Ook. Ook! Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook. Ook! Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook. Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook! Ook. Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook! Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook. Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook. Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook. Ook. Ook? Ook. Ook? Ook. Ook. Ook! Ook.
Oroogu
d / ("Hello, world!")
Orthogonal
0 'd' 'l' 'r' 'o' 'w' ' ' ',' 'o' 'l' 'l' 'e' 'h' s 0 c 0 ret
Pandora
hello world forget come from "hello" print "Hello, " return come from "world" print "world !" return
PleasePorigeHot
1 Please porige hot or cold Hello World!
Piet
Piet_hello2_big.png
reMorse
Note that this is not a complete "Hello, world!" program.
- - - ..- ...-.---.;newline - - - .-. - ..-.- ...-. ---.;! - - - ...- . . -.---.;d ----. . . -.---.;l ----. . -...---.;r ----. -...---.;o ----...-.- ..-. ---.;W <i didn't feel like doing this part> -..............;output all characters
RUBE
0a21646c726f77202c6f6c6c6548 , :::::::::::::::::::::::::::: , ) ============================== F O F c =
Sally
sidefxio void main print 'H print 'e print 'l print 'l print 'o print ', print as char 32 print 'w print 'o print 'r print 'l print 'd print '!
Sansism
G GGG >++++++++++>!+++++++!++++++++++!+++!+##!!!!##-G+G G.+++++++++++++++##!!##.++!.+++..+++++++.+!.++! G G!.+++.------.--------.!+.!.G GG
Shakespeare
See [2] (http://shakespearelang.sourceforge.net/report/shakespeare/shakespeare.html#sec:hello) for a Hello, World program in Shakespeare.
Shelta
[ `Hello, _32 `world! _13 _10 ] \15 outs \0 halt
SMITH
; Hello, world in SMITH - version 2 (loop) ; R0 -> index into string (starts at R10) ; R2 -> -1 MOV R0, 10 MOV R2, 0 SUB R2, 1 MOV R[R0], "Hello, world!" MOV TTY, R[R0] SUB R0, R2 MOV R1, R0 SUB R1, 23 NOT R1 NOT R1 MUL R1, 8 COR +1, -7, R1
Spaghetti
10[?100]11 9[?108]10 13[?101]2 12[?10]0 4[?111]5 8[?114]9 2[?108]3 11[?33]12 6[?87]7 3[?108]4 1[?48]13 5[?32]6 7[?111]8
Spoon
0101111111110010001111111111010000001101100101001011111110010001111110 1000000110111001010111111100101000101011100101001011111111111001000110 0000000000000000001000000110110000010100000000000000000000000000000000 0000000101001011111111111001000111111101000000110110010100101111110010 0011111101000000110110010101110010100000000000000000000010100000000000 0000000000000000101001011111111111001000110000000000000000000100000011 011000001010
Toadskin
:V+++++;:XVV;:v-----;:xvv;XXXXXXX++.<XXXXXXXXXX+.V ++..+++.<XXX++.>>XV.XX++++.+++.v-.x++.<XXX+++.<X.>
TRANSCRIPT
In the House You are inside the small blue house on Pine St. The floor is carpeted and the walls are paneled in a light coloured wood. The door is to the north. Julie is here. >JULIE, Hello, world! Julie doesn't respond. >X JULIE Julie is a twentysomething woman with short brunette hair. >QUIT
Unlambda
`r```````````.H.e.l.l.o. .w.o.r.l.di
var'aq
Note: actually prints "What do you want, universe?" in Klingon.
~ nuqneH { ~ 'u' ~ nuqneH disp disp } name nuqneH
*W
Functions: || No functions for this program !! Stuff: 1/Hello is chrs! 1/Sz, 1/Total are all cplx! Text: || Initialize the data !! Hello < "Hello, world!"! Size Hello > Sz! Total < 0! || Take the string length and multiply by 100 !! - Size - 0 Total > Total %10000! || Print and delete a character that many times !! & WORLD < FCHRS (Hello)! & Hello < - Hello FCHRS (Hello)! && %Total! || Add a newline !! WORLD < nl! :Endtext
Whenever
1 print("Hello world!");
Whirl
11001110011100000111110000000100001111100001111110000000001000001100111110000110 00100000100111110001000000000000010011111000001111100010000000000000000010001111 10010000001100001111100011000000000100111110011100111000111000001000111000001111 10000011111001000001111100011001111110000111100000111100000111001111110000111100 01100111000001110001000111110000011111001000001100000001110000011100011111000111 11000111000001000001000011000111110001000001000000011100000111001000111110001111 00000111100001111110000111111000001111000000000000000001111000001110011100001111 00111110001111100011111000001000000000000000000000001111100011100000011100000111 00011100111110001000100000000011100001111100110000000010011111000111100000111100 11110001001110000011111000001111100110011110001000111100000000000100011111001000 00100111100110011100010001111100011000001000111110000111100111001111110001111000 00111100011111000000011110000011100100001111000100011111001100011111000111100000 11100111000110011110010000000000000001111100000111110001001000001110000111110010 00001000111000001110001100111100010011111100011000001111000111110001111000001110 01000011110001001111100000111110000000011110000011110000000000000000111000001110 00001100000110000011100011100000110011111000011111100100111000001111100000110001 1000001001111110000011100110011111000000000111000001110000111100001100
Whitespace
Please see [3] (http://compsoc.dur.ac.uk/whitespace/hworld.ws) for a Hello, world program in Whitespace.
Wierd
H ************************ ****************** ********** e * * * * * * * l * *** * ** * * * * * ! o * *** * * * * * * * * * , * * * ** * * * * * * * * W * * * * * * * * * * * ** * r * * * * * * ************ * * * * * * * d * * * * * * * * ****** * * * * * * * * * * ** ** * * * * * * * * ** * * * * * * * ** * * * * * * * * ** ** * * * * * * * * * * ** ** * ** * * * * ******************** * * * ** * ** **** *** * * ** * * ** * ** * * ** * * * ** * ** * * ** * ** * ** ** * ** * ***** * ** * * ** ** ** * ** * * ** * * * * ************************************************************* * ***************************** * * * * *** * * * * * * * * * ** * * * * * * * * ** ****** * ********************* * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * ** * * * * * * * ***** ** * * * * * * ** * ** ** * * * * * * ** * ** ** ***** * * * * * ** * * ** * * * * * ** ** * * ** * ** * * * * ** ***** ** ** * ** * * * * ** ** * * * * * ** ** * * * ** * ** * ** * * * * * * * * ************************************************************* * * * ** * * * * * * ** * * * * * * * * * * ************************* ** * * * * * * * * * * * * * * * *** * * * * * * * * * * ************** * * * * * ** * * * * * ** ** * * * * * * * * *** * * * * ** ** ******* * ** * * * ** * * * * ** * * * * * * * * * * ** * * * * * * * * * ** * * * * * * * * * ** * * * * * * * * * * ** * * * * * * * ** * * ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * * * * * ***** * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * ***************************** * * * * *********************************************************************************************** * * * * * * ** * * ** ** * * ** * * * ** * * * ** * * * ** * * * ** * ****** * * **** ** * * * ****************** * * * ** ** ** * * * * * ** ** * ** * * * * * * * * * * * * * * ***** * * * * * * * * * * * * ** * * * * * * * * * * * ******* * * ** ** * ** ** * * ** ** * ** ************************ ** ** * * * * ** * * * * * * * * * ** * * * * * * * * * * * * * * * * * * ** * * * ** * * * * ** * * * ** * ** ** * * ** ****************************** ** ** ** ** ** ** ** ** ** ** * ** * ** * ** * ** * ** ** ** *************** ** ** ** * ** ** ** *************** ** *
WIZ-DOS
greeting exe
HELLO WORLD
XS
<print>Hello World</print>