Shotgun sequencing
|
|
Shotgun sequencing is a method used in genetics for sequencing long DNA strands. Since the chain termination method can only be used for fairly short strands, it is necessary to divide longer sequences up and then "assemble" the results to give the overall sequence. In chromosome walking, this division is done by progressing through the entire strand, piece by piece; shotgun sequencing uses a faster, but more complex, process to assemble random pieces of the sequence.
In this technique, small segments of the target DNA strand are cloned randomly, and then these clones are sequenced using the chain termination method. By doing this for several copies of the same long DNA strand, overlapping fragments are created. Finally, computer programs align these overlapping sequences and determine the original (long) sequence.
An extremely simplified example with only two sequences is as follows:
Original strand : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
First shotgun sequence : XXXAGCATGCTGCAG
TCATGCTTAGGCTAXXXX
Second shotgun sequence : TTAGGCTAXXXX
XXXAGCATGCTGCAGTCATGC
Reconstructed strand : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
In real-world applications, there are thousands or millions of sequences to deal with, with the addition of transcription and sequencing errors. The computational power required to re-align the sequence in real projects is enormous. For the shotgun sequencing of the human genome in the Human Genome Project run by Celera Genomics in 2000, several supercomputers were running some months nonstop to align all human DNA correctly.